| Description |
T7 RNA Polymerase catalyzes the 5'->3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from a T7 phage promoter (TAATACGACTCACTATAGGGAGA). |
| Applications |
- Radiolabeled RNA probe preparation
- RNA generation for in vitro translation
- RNA generation for studies of RNA structure, processing and catalysis
- Expression control via anti-sense RNA
|
| Source |
Purified from a strain of E. coli that expresses the recombinant T7 RNA Polymerase gene (gene I) |
| Unit Definition |
One unit is defined as the amount of enzyme that will incorporate 1 nmol of ATP into acid-precipitable material in 1 hour at 37°C. |
| Components |
- T7 RNA Polymerase: 50,000 U/ml in 50 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50% glycerol, 0.1% Triton X-100, pH 7.9 @ 25°C
- 10X Reaction Buffer: 400 mM Tris-HCl, 60 mM MgCl2, 100 mM DTT, 20 mM, Spermidine, pH 7.9 @ 25°C
|
| Quality Control |
- The absence of endo-, exodeoxyribonucleases and ribonucleases confirmed by appropriate tests.
- Functionally tested in in vitro transcription reaction.
|
| Storage Condition |
-20 °C |