| Product Name |
T7 RNA Polymerase |
| Catalog Number |
EG-1060 |
| Description |
T7 RNA Polymerase, a recombinant enzyme from bacteriophage T7 expressed in Escherichia coli, catalyzes 5’ to 3’ RNA synthesis from single-stranded or double-stranded DNA templates downstream of a T7 promoter (TAATACGACTCACTATAGGGAGA), ideal for RNA probe preparation and in vitro transcription studies. |
| Applications |
- Radiolabeled RNA probe preparation
- RNA synthesis for in vitro translation
- RNA synthesis for studies of RNA structure, processing, and catalysis
- Expression control via antisense RNA
|
| Source |
Recombinant Escherichia coli expressing the T7 bacteriophage gene 1 |
| Unit Definition |
One unit is defined as the amount of enzyme that incorporates 1 nmol of ATP into acid-insoluble material in 1 hour at 37°C under standard RNA polymerase assay conditions. |
| Components |
- T7 RNA Polymerase: 50,000 units/mL in 50 mM Tris-HCl (pH 7.9 at 25°C), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 0.1% (v/v) Triton X-100, 50% (v/v) glycerol
- 10X Reaction Buffer: 400 mM Tris-HCl (pH 7.9 at 25°C), 60 mM MgCl2, 100 mM DTT, 20 mM spermidine
|
| Quality Control |
- Absence of endo- and exodeoxyribonucleases and ribonucleases confirmed by appropriate quality tests
- Functionally validated in in vitro transcription reactions
|
| Storage |
-20°C |
| Shipping |
Dry ice |
|